ID: 905484736

View in Genome Browser
Species Human (GRCh38)
Location 1:38287236-38287258
Sequence CAGTGCGAGGCGTGGGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905484726_905484736 6 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484721_905484736 28 Left 905484721 1:38287185-38287207 CCAGGGCCTCTGTGGGCCTCTTC No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484730_905484736 -6 Left 905484730 1:38287219-38287241 CCTCCTAGAGCAGGCCACAGTGC No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484723_905484736 22 Left 905484723 1:38287191-38287213 CCTCTGTGGGCCTCTTCCCTGGG No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484727_905484736 5 Left 905484727 1:38287208-38287230 CCTGGGTCCATCCTCCTAGAGCA No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484731_905484736 -9 Left 905484731 1:38287222-38287244 CCTAGAGCAGGCCACAGTGCGAG No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484725_905484736 12 Left 905484725 1:38287201-38287223 CCTCTTCCCTGGGTCCATCCTCC No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data
905484729_905484736 -2 Left 905484729 1:38287215-38287237 CCATCCTCCTAGAGCAGGCCACA No data
Right 905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905484736 Original CRISPR CAGTGCGAGGCGTGGGCAAA AGG Intergenic
No off target data available for this crispr