ID: 905484737

View in Genome Browser
Species Human (GRCh38)
Location 1:38287250-38287272
Sequence GGCAAAAGGCAGCTGCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905484731_905484737 5 Left 905484731 1:38287222-38287244 CCTAGAGCAGGCCACAGTGCGAG No data
Right 905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG No data
905484735_905484737 -6 Left 905484735 1:38287233-38287255 CCACAGTGCGAGGCGTGGGCAAA No data
Right 905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG No data
905484726_905484737 20 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG No data
905484730_905484737 8 Left 905484730 1:38287219-38287241 CCTCCTAGAGCAGGCCACAGTGC No data
Right 905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG No data
905484727_905484737 19 Left 905484727 1:38287208-38287230 CCTGGGTCCATCCTCCTAGAGCA No data
Right 905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG No data
905484729_905484737 12 Left 905484729 1:38287215-38287237 CCATCCTCCTAGAGCAGGCCACA No data
Right 905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG No data
905484725_905484737 26 Left 905484725 1:38287201-38287223 CCTCTTCCCTGGGTCCATCCTCC No data
Right 905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905484737 Original CRISPR GGCAAAAGGCAGCTGCTTGC AGG Intergenic
No off target data available for this crispr