ID: 905484739

View in Genome Browser
Species Human (GRCh38)
Location 1:38287257-38287279
Sequence GGCAGCTGCTTGCAGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905484729_905484739 19 Left 905484729 1:38287215-38287237 CCATCCTCCTAGAGCAGGCCACA No data
Right 905484739 1:38287257-38287279 GGCAGCTGCTTGCAGGTGTTGGG No data
905484731_905484739 12 Left 905484731 1:38287222-38287244 CCTAGAGCAGGCCACAGTGCGAG No data
Right 905484739 1:38287257-38287279 GGCAGCTGCTTGCAGGTGTTGGG No data
905484730_905484739 15 Left 905484730 1:38287219-38287241 CCTCCTAGAGCAGGCCACAGTGC No data
Right 905484739 1:38287257-38287279 GGCAGCTGCTTGCAGGTGTTGGG No data
905484735_905484739 1 Left 905484735 1:38287233-38287255 CCACAGTGCGAGGCGTGGGCAAA No data
Right 905484739 1:38287257-38287279 GGCAGCTGCTTGCAGGTGTTGGG No data
905484727_905484739 26 Left 905484727 1:38287208-38287230 CCTGGGTCCATCCTCCTAGAGCA No data
Right 905484739 1:38287257-38287279 GGCAGCTGCTTGCAGGTGTTGGG No data
905484726_905484739 27 Left 905484726 1:38287207-38287229 CCCTGGGTCCATCCTCCTAGAGC No data
Right 905484739 1:38287257-38287279 GGCAGCTGCTTGCAGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905484739 Original CRISPR GGCAGCTGCTTGCAGGTGTT GGG Intergenic
No off target data available for this crispr