ID: 905485375

View in Genome Browser
Species Human (GRCh38)
Location 1:38292408-38292430
Sequence CGGGCCGGTGGGGAGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485375_905485388 0 Left 905485375 1:38292408-38292430 CCCCCAGGCTCCCCACCGGCCCG No data
Right 905485388 1:38292431-38292453 CTGCCCAGCCTGGGGAGCCCTGG No data
905485375_905485389 1 Left 905485375 1:38292408-38292430 CCCCCAGGCTCCCCACCGGCCCG No data
Right 905485389 1:38292432-38292454 TGCCCAGCCTGGGGAGCCCTGGG No data
905485375_905485383 -9 Left 905485375 1:38292408-38292430 CCCCCAGGCTCCCCACCGGCCCG No data
Right 905485383 1:38292422-38292444 ACCGGCCCGCTGCCCAGCCTGGG No data
905485375_905485395 18 Left 905485375 1:38292408-38292430 CCCCCAGGCTCCCCACCGGCCCG No data
Right 905485395 1:38292449-38292471 CCTGGGCAGAACGCTTGATCCGG No data
905485375_905485398 30 Left 905485375 1:38292408-38292430 CCCCCAGGCTCCCCACCGGCCCG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485375_905485382 -10 Left 905485375 1:38292408-38292430 CCCCCAGGCTCCCCACCGGCCCG No data
Right 905485382 1:38292421-38292443 CACCGGCCCGCTGCCCAGCCTGG No data
905485375_905485397 29 Left 905485375 1:38292408-38292430 CCCCCAGGCTCCCCACCGGCCCG No data
Right 905485397 1:38292460-38292482 CGCTTGATCCGGAGCCGGACTGG No data
905485375_905485385 -8 Left 905485375 1:38292408-38292430 CCCCCAGGCTCCCCACCGGCCCG No data
Right 905485385 1:38292423-38292445 CCGGCCCGCTGCCCAGCCTGGGG No data
905485375_905485396 24 Left 905485375 1:38292408-38292430 CCCCCAGGCTCCCCACCGGCCCG No data
Right 905485396 1:38292455-38292477 CAGAACGCTTGATCCGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485375 Original CRISPR CGGGCCGGTGGGGAGCCTGG GGG (reversed) Intergenic
No off target data available for this crispr