ID: 905485376

View in Genome Browser
Species Human (GRCh38)
Location 1:38292409-38292431
Sequence GCGGGCCGGTGGGGAGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485376_905485385 -9 Left 905485376 1:38292409-38292431 CCCCAGGCTCCCCACCGGCCCGC No data
Right 905485385 1:38292423-38292445 CCGGCCCGCTGCCCAGCCTGGGG No data
905485376_905485383 -10 Left 905485376 1:38292409-38292431 CCCCAGGCTCCCCACCGGCCCGC No data
Right 905485383 1:38292422-38292444 ACCGGCCCGCTGCCCAGCCTGGG No data
905485376_905485398 29 Left 905485376 1:38292409-38292431 CCCCAGGCTCCCCACCGGCCCGC No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485376_905485388 -1 Left 905485376 1:38292409-38292431 CCCCAGGCTCCCCACCGGCCCGC No data
Right 905485388 1:38292431-38292453 CTGCCCAGCCTGGGGAGCCCTGG No data
905485376_905485389 0 Left 905485376 1:38292409-38292431 CCCCAGGCTCCCCACCGGCCCGC No data
Right 905485389 1:38292432-38292454 TGCCCAGCCTGGGGAGCCCTGGG No data
905485376_905485396 23 Left 905485376 1:38292409-38292431 CCCCAGGCTCCCCACCGGCCCGC No data
Right 905485396 1:38292455-38292477 CAGAACGCTTGATCCGGAGCCGG No data
905485376_905485397 28 Left 905485376 1:38292409-38292431 CCCCAGGCTCCCCACCGGCCCGC No data
Right 905485397 1:38292460-38292482 CGCTTGATCCGGAGCCGGACTGG No data
905485376_905485395 17 Left 905485376 1:38292409-38292431 CCCCAGGCTCCCCACCGGCCCGC No data
Right 905485395 1:38292449-38292471 CCTGGGCAGAACGCTTGATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485376 Original CRISPR GCGGGCCGGTGGGGAGCCTG GGG (reversed) Intergenic
No off target data available for this crispr