ID: 905485377

View in Genome Browser
Species Human (GRCh38)
Location 1:38292410-38292432
Sequence AGCGGGCCGGTGGGGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485377_905485388 -2 Left 905485377 1:38292410-38292432 CCCAGGCTCCCCACCGGCCCGCT No data
Right 905485388 1:38292431-38292453 CTGCCCAGCCTGGGGAGCCCTGG No data
905485377_905485398 28 Left 905485377 1:38292410-38292432 CCCAGGCTCCCCACCGGCCCGCT No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485377_905485397 27 Left 905485377 1:38292410-38292432 CCCAGGCTCCCCACCGGCCCGCT No data
Right 905485397 1:38292460-38292482 CGCTTGATCCGGAGCCGGACTGG No data
905485377_905485385 -10 Left 905485377 1:38292410-38292432 CCCAGGCTCCCCACCGGCCCGCT No data
Right 905485385 1:38292423-38292445 CCGGCCCGCTGCCCAGCCTGGGG No data
905485377_905485395 16 Left 905485377 1:38292410-38292432 CCCAGGCTCCCCACCGGCCCGCT No data
Right 905485395 1:38292449-38292471 CCTGGGCAGAACGCTTGATCCGG No data
905485377_905485389 -1 Left 905485377 1:38292410-38292432 CCCAGGCTCCCCACCGGCCCGCT No data
Right 905485389 1:38292432-38292454 TGCCCAGCCTGGGGAGCCCTGGG No data
905485377_905485396 22 Left 905485377 1:38292410-38292432 CCCAGGCTCCCCACCGGCCCGCT No data
Right 905485396 1:38292455-38292477 CAGAACGCTTGATCCGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485377 Original CRISPR AGCGGGCCGGTGGGGAGCCT GGG (reversed) Intergenic
No off target data available for this crispr