ID: 905485378

View in Genome Browser
Species Human (GRCh38)
Location 1:38292411-38292433
Sequence CAGCGGGCCGGTGGGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485378_905485398 27 Left 905485378 1:38292411-38292433 CCAGGCTCCCCACCGGCCCGCTG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485378_905485395 15 Left 905485378 1:38292411-38292433 CCAGGCTCCCCACCGGCCCGCTG No data
Right 905485395 1:38292449-38292471 CCTGGGCAGAACGCTTGATCCGG No data
905485378_905485388 -3 Left 905485378 1:38292411-38292433 CCAGGCTCCCCACCGGCCCGCTG No data
Right 905485388 1:38292431-38292453 CTGCCCAGCCTGGGGAGCCCTGG No data
905485378_905485397 26 Left 905485378 1:38292411-38292433 CCAGGCTCCCCACCGGCCCGCTG No data
Right 905485397 1:38292460-38292482 CGCTTGATCCGGAGCCGGACTGG No data
905485378_905485396 21 Left 905485378 1:38292411-38292433 CCAGGCTCCCCACCGGCCCGCTG No data
Right 905485396 1:38292455-38292477 CAGAACGCTTGATCCGGAGCCGG No data
905485378_905485389 -2 Left 905485378 1:38292411-38292433 CCAGGCTCCCCACCGGCCCGCTG No data
Right 905485389 1:38292432-38292454 TGCCCAGCCTGGGGAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485378 Original CRISPR CAGCGGGCCGGTGGGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr