ID: 905485384

View in Genome Browser
Species Human (GRCh38)
Location 1:38292423-38292445
Sequence CCCCAGGCTGGGCAGCGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485384_905485397 14 Left 905485384 1:38292423-38292445 CCGGCCCGCTGCCCAGCCTGGGG No data
Right 905485397 1:38292460-38292482 CGCTTGATCCGGAGCCGGACTGG No data
905485384_905485395 3 Left 905485384 1:38292423-38292445 CCGGCCCGCTGCCCAGCCTGGGG No data
Right 905485395 1:38292449-38292471 CCTGGGCAGAACGCTTGATCCGG No data
905485384_905485398 15 Left 905485384 1:38292423-38292445 CCGGCCCGCTGCCCAGCCTGGGG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485384_905485396 9 Left 905485384 1:38292423-38292445 CCGGCCCGCTGCCCAGCCTGGGG No data
Right 905485396 1:38292455-38292477 CAGAACGCTTGATCCGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485384 Original CRISPR CCCCAGGCTGGGCAGCGGGC CGG (reversed) Intergenic
No off target data available for this crispr