ID: 905485391

View in Genome Browser
Species Human (GRCh38)
Location 1:38292435-38292457
Sequence CTGCCCAGGGCTCCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485391_905485398 3 Left 905485391 1:38292435-38292457 CCAGCCTGGGGAGCCCTGGGCAG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485391_905485396 -3 Left 905485391 1:38292435-38292457 CCAGCCTGGGGAGCCCTGGGCAG No data
Right 905485396 1:38292455-38292477 CAGAACGCTTGATCCGGAGCCGG No data
905485391_905485395 -9 Left 905485391 1:38292435-38292457 CCAGCCTGGGGAGCCCTGGGCAG No data
Right 905485395 1:38292449-38292471 CCTGGGCAGAACGCTTGATCCGG No data
905485391_905485397 2 Left 905485391 1:38292435-38292457 CCAGCCTGGGGAGCCCTGGGCAG No data
Right 905485397 1:38292460-38292482 CGCTTGATCCGGAGCCGGACTGG No data
905485391_905485401 29 Left 905485391 1:38292435-38292457 CCAGCCTGGGGAGCCCTGGGCAG No data
Right 905485401 1:38292487-38292509 TCCCACTGCTTCCCCGTCGCTGG No data
905485391_905485403 30 Left 905485391 1:38292435-38292457 CCAGCCTGGGGAGCCCTGGGCAG No data
Right 905485403 1:38292488-38292510 CCCACTGCTTCCCCGTCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485391 Original CRISPR CTGCCCAGGGCTCCCCAGGC TGG (reversed) Intergenic
No off target data available for this crispr