ID: 905485392

View in Genome Browser
Species Human (GRCh38)
Location 1:38292439-38292461
Sequence CGTTCTGCCCAGGGCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485392_905485401 25 Left 905485392 1:38292439-38292461 CCTGGGGAGCCCTGGGCAGAACG No data
Right 905485401 1:38292487-38292509 TCCCACTGCTTCCCCGTCGCTGG No data
905485392_905485398 -1 Left 905485392 1:38292439-38292461 CCTGGGGAGCCCTGGGCAGAACG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485392_905485396 -7 Left 905485392 1:38292439-38292461 CCTGGGGAGCCCTGGGCAGAACG No data
Right 905485396 1:38292455-38292477 CAGAACGCTTGATCCGGAGCCGG No data
905485392_905485403 26 Left 905485392 1:38292439-38292461 CCTGGGGAGCCCTGGGCAGAACG No data
Right 905485403 1:38292488-38292510 CCCACTGCTTCCCCGTCGCTGGG No data
905485392_905485397 -2 Left 905485392 1:38292439-38292461 CCTGGGGAGCCCTGGGCAGAACG No data
Right 905485397 1:38292460-38292482 CGCTTGATCCGGAGCCGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485392 Original CRISPR CGTTCTGCCCAGGGCTCCCC AGG (reversed) Intergenic
No off target data available for this crispr