ID: 905485393

View in Genome Browser
Species Human (GRCh38)
Location 1:38292448-38292470
Sequence CGGATCAAGCGTTCTGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485393_905485403 17 Left 905485393 1:38292448-38292470 CCCTGGGCAGAACGCTTGATCCG No data
Right 905485403 1:38292488-38292510 CCCACTGCTTCCCCGTCGCTGGG No data
905485393_905485405 23 Left 905485393 1:38292448-38292470 CCCTGGGCAGAACGCTTGATCCG No data
Right 905485405 1:38292494-38292516 GCTTCCCCGTCGCTGGGAACAGG No data
905485393_905485401 16 Left 905485393 1:38292448-38292470 CCCTGGGCAGAACGCTTGATCCG No data
Right 905485401 1:38292487-38292509 TCCCACTGCTTCCCCGTCGCTGG No data
905485393_905485409 29 Left 905485393 1:38292448-38292470 CCCTGGGCAGAACGCTTGATCCG No data
Right 905485409 1:38292500-38292522 CCGTCGCTGGGAACAGGCCCTGG No data
905485393_905485398 -10 Left 905485393 1:38292448-38292470 CCCTGGGCAGAACGCTTGATCCG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485393 Original CRISPR CGGATCAAGCGTTCTGCCCA GGG (reversed) Intergenic
No off target data available for this crispr