ID: 905485398

View in Genome Browser
Species Human (GRCh38)
Location 1:38292461-38292483
Sequence GCTTGATCCGGAGCCGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485381_905485398 18 Left 905485381 1:38292420-38292442 CCACCGGCCCGCTGCCCAGCCTG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485392_905485398 -1 Left 905485392 1:38292439-38292461 CCTGGGGAGCCCTGGGCAGAACG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485384_905485398 15 Left 905485384 1:38292423-38292445 CCGGCCCGCTGCCCAGCCTGGGG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485378_905485398 27 Left 905485378 1:38292411-38292433 CCAGGCTCCCCACCGGCCCGCTG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485376_905485398 29 Left 905485376 1:38292409-38292431 CCCCAGGCTCCCCACCGGCCCGC No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485386_905485398 11 Left 905485386 1:38292427-38292449 CCCGCTGCCCAGCCTGGGGAGCC No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485393_905485398 -10 Left 905485393 1:38292448-38292470 CCCTGGGCAGAACGCTTGATCCG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485391_905485398 3 Left 905485391 1:38292435-38292457 CCAGCCTGGGGAGCCCTGGGCAG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485380_905485398 19 Left 905485380 1:38292419-38292441 CCCACCGGCCCGCTGCCCAGCCT No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485375_905485398 30 Left 905485375 1:38292408-38292430 CCCCCAGGCTCCCCACCGGCCCG No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485377_905485398 28 Left 905485377 1:38292410-38292432 CCCAGGCTCCCCACCGGCCCGCT No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485379_905485398 20 Left 905485379 1:38292418-38292440 CCCCACCGGCCCGCTGCCCAGCC No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485387_905485398 10 Left 905485387 1:38292428-38292450 CCGCTGCCCAGCCTGGGGAGCCC No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data
905485390_905485398 4 Left 905485390 1:38292434-38292456 CCCAGCCTGGGGAGCCCTGGGCA No data
Right 905485398 1:38292461-38292483 GCTTGATCCGGAGCCGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485398 Original CRISPR GCTTGATCCGGAGCCGGACT GGG Intergenic
No off target data available for this crispr