ID: 905485725

View in Genome Browser
Species Human (GRCh38)
Location 1:38294842-38294864
Sequence TTCAAGACACCATCTTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485725_905485733 23 Left 905485725 1:38294842-38294864 CCACACCAAGATGGTGTCTTGAA No data
Right 905485733 1:38294888-38294910 AACACTGTATCCTCATATGGAGG No data
905485725_905485727 -5 Left 905485725 1:38294842-38294864 CCACACCAAGATGGTGTCTTGAA No data
Right 905485727 1:38294860-38294882 TTGAATGCCATATGCTCCAGAGG No data
905485725_905485729 0 Left 905485725 1:38294842-38294864 CCACACCAAGATGGTGTCTTGAA No data
Right 905485729 1:38294865-38294887 TGCCATATGCTCCAGAGGGAAGG No data
905485725_905485728 -4 Left 905485725 1:38294842-38294864 CCACACCAAGATGGTGTCTTGAA No data
Right 905485728 1:38294861-38294883 TGAATGCCATATGCTCCAGAGGG No data
905485725_905485734 27 Left 905485725 1:38294842-38294864 CCACACCAAGATGGTGTCTTGAA No data
Right 905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG No data
905485725_905485732 20 Left 905485725 1:38294842-38294864 CCACACCAAGATGGTGTCTTGAA No data
Right 905485732 1:38294885-38294907 AGGAACACTGTATCCTCATATGG 0: 2
1: 8
2: 54
3: 148
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485725 Original CRISPR TTCAAGACACCATCTTGGTG TGG (reversed) Intergenic
No off target data available for this crispr