ID: 905485726

View in Genome Browser
Species Human (GRCh38)
Location 1:38294847-38294869
Sequence TGGCATTCAAGACACCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485726_905485733 18 Left 905485726 1:38294847-38294869 CCAAGATGGTGTCTTGAATGCCA No data
Right 905485733 1:38294888-38294910 AACACTGTATCCTCATATGGAGG No data
905485726_905485729 -5 Left 905485726 1:38294847-38294869 CCAAGATGGTGTCTTGAATGCCA No data
Right 905485729 1:38294865-38294887 TGCCATATGCTCCAGAGGGAAGG No data
905485726_905485727 -10 Left 905485726 1:38294847-38294869 CCAAGATGGTGTCTTGAATGCCA No data
Right 905485727 1:38294860-38294882 TTGAATGCCATATGCTCCAGAGG No data
905485726_905485737 30 Left 905485726 1:38294847-38294869 CCAAGATGGTGTCTTGAATGCCA No data
Right 905485737 1:38294900-38294922 TCATATGGAGGAAGGCCAAAGGG No data
905485726_905485734 22 Left 905485726 1:38294847-38294869 CCAAGATGGTGTCTTGAATGCCA No data
Right 905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG No data
905485726_905485736 29 Left 905485726 1:38294847-38294869 CCAAGATGGTGTCTTGAATGCCA No data
Right 905485736 1:38294899-38294921 CTCATATGGAGGAAGGCCAAAGG No data
905485726_905485728 -9 Left 905485726 1:38294847-38294869 CCAAGATGGTGTCTTGAATGCCA No data
Right 905485728 1:38294861-38294883 TGAATGCCATATGCTCCAGAGGG No data
905485726_905485732 15 Left 905485726 1:38294847-38294869 CCAAGATGGTGTCTTGAATGCCA No data
Right 905485732 1:38294885-38294907 AGGAACACTGTATCCTCATATGG 0: 2
1: 8
2: 54
3: 148
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485726 Original CRISPR TGGCATTCAAGACACCATCT TGG (reversed) Intergenic
No off target data available for this crispr