ID: 905485731

View in Genome Browser
Species Human (GRCh38)
Location 1:38294876-38294898
Sequence GATACAGTGTTCCTTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485731_905485737 1 Left 905485731 1:38294876-38294898 CCAGAGGGAAGGAACACTGTATC No data
Right 905485737 1:38294900-38294922 TCATATGGAGGAAGGCCAAAGGG No data
905485731_905485736 0 Left 905485731 1:38294876-38294898 CCAGAGGGAAGGAACACTGTATC No data
Right 905485736 1:38294899-38294921 CTCATATGGAGGAAGGCCAAAGG No data
905485731_905485734 -7 Left 905485731 1:38294876-38294898 CCAGAGGGAAGGAACACTGTATC No data
Right 905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG No data
905485731_905485738 8 Left 905485731 1:38294876-38294898 CCAGAGGGAAGGAACACTGTATC No data
Right 905485738 1:38294907-38294929 GAGGAAGGCCAAAGGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485731 Original CRISPR GATACAGTGTTCCTTCCCTC TGG (reversed) Intergenic
No off target data available for this crispr