ID: 905485734

View in Genome Browser
Species Human (GRCh38)
Location 1:38294892-38294914
Sequence CTGTATCCTCATATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485731_905485734 -7 Left 905485731 1:38294876-38294898 CCAGAGGGAAGGAACACTGTATC No data
Right 905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG No data
905485726_905485734 22 Left 905485726 1:38294847-38294869 CCAAGATGGTGTCTTGAATGCCA No data
Right 905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG No data
905485730_905485734 2 Left 905485730 1:38294867-38294889 CCATATGCTCCAGAGGGAAGGAA No data
Right 905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG No data
905485725_905485734 27 Left 905485725 1:38294842-38294864 CCACACCAAGATGGTGTCTTGAA No data
Right 905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485734 Original CRISPR CTGTATCCTCATATGGAGGA AGG Intergenic
No off target data available for this crispr