ID: 905485980

View in Genome Browser
Species Human (GRCh38)
Location 1:38296928-38296950
Sequence AGGGTGGGTGGGCCTGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905485980_905485992 25 Left 905485980 1:38296928-38296950 CCCTCTCCAGGCCCACCCACCCT No data
Right 905485992 1:38296976-38296998 TTTTCATAGTTTCTTGTCTATGG No data
905485980_905485988 -6 Left 905485980 1:38296928-38296950 CCCTCTCCAGGCCCACCCACCCT No data
Right 905485988 1:38296945-38296967 CACCCTAATGGCACTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905485980 Original CRISPR AGGGTGGGTGGGCCTGGAGA GGG (reversed) Intergenic