ID: 905485980 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:38296928-38296950 |
Sequence | AGGGTGGGTGGGCCTGGAGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
905485980_905485992 | 25 | Left | 905485980 | 1:38296928-38296950 | CCCTCTCCAGGCCCACCCACCCT | No data | ||
Right | 905485992 | 1:38296976-38296998 | TTTTCATAGTTTCTTGTCTATGG | No data | ||||
905485980_905485988 | -6 | Left | 905485980 | 1:38296928-38296950 | CCCTCTCCAGGCCCACCCACCCT | No data | ||
Right | 905485988 | 1:38296945-38296967 | CACCCTAATGGCACTTTCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
905485980 | Original CRISPR | AGGGTGGGTGGGCCTGGAGA GGG (reversed) | Intergenic | ||