ID: 905491610

View in Genome Browser
Species Human (GRCh38)
Location 1:38348663-38348685
Sequence CTTGGATTATCACCAAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905491610_905491612 3 Left 905491610 1:38348663-38348685 CCTGGTTTTGGTGATAATCCAAG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 905491612 1:38348689-38348711 TTTCTACTGTCCATCTCCACTGG 0: 1
1: 0
2: 3
3: 22
4: 229
905491610_905491615 21 Left 905491610 1:38348663-38348685 CCTGGTTTTGGTGATAATCCAAG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 905491615 1:38348707-38348729 ACTGGCCCTGCCTTAGCCCCAGG 0: 1
1: 0
2: 4
3: 40
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905491610 Original CRISPR CTTGGATTATCACCAAAACC AGG (reversed) Intergenic
905491610 1:38348663-38348685 CTTGGATTATCACCAAAACCAGG - Intergenic
906838094 1:49105847-49105869 ATTGGATTATCATCAAAAAAAGG - Intronic
911774756 1:101794476-101794498 GTTTGACTTTCACCAAAACCAGG - Intergenic
913963821 1:143358501-143358523 CTAAGATTGTCACCAACACCAGG - Intergenic
914058183 1:144184105-144184127 CTAAGATTGTCACCAACACCAGG - Intergenic
914120963 1:144782266-144782288 CTAAGATTGTCACCAACACCAGG + Intergenic
916779801 1:168012720-168012742 CTTGGATTAAAAACAAAATCAGG - Intronic
918542849 1:185650168-185650190 CTTGGAGCATGGCCAAAACCAGG + Intergenic
923659859 1:235948727-235948749 CTAGGATGATCACAAAAAACAGG + Intergenic
1062963068 10:1588350-1588372 CTTTGTTGATCACCAAATCCAGG - Intronic
1065351380 10:24798518-24798540 TTTAGATTATCCCCAATACCTGG - Intergenic
1066255769 10:33677164-33677186 CCTGGCTCATCACCAAAGCCTGG + Intergenic
1071349489 10:84725517-84725539 CATTCATAATCACCAAAACCAGG - Intergenic
1073839825 10:107485351-107485373 CTTGGATTATTCCCCAAATCAGG - Intergenic
1081614058 11:44579954-44579976 CTTGGATGATCACAGAAACAGGG + Intronic
1082794651 11:57370387-57370409 CTTGGTTTATCTTCAAAACAAGG - Exonic
1085420106 11:76350083-76350105 CTTGATTTATAAGCAAAACCTGG - Exonic
1086273114 11:85092268-85092290 TTGGGATTATGACCAAAACCTGG - Intronic
1086401602 11:86465420-86465442 CTTGGCTGACCACCAAAGCCAGG - Intronic
1088102188 11:106167770-106167792 CTTGGAGCATGGCCAAAACCAGG + Intergenic
1092064011 12:5574543-5574565 CTAGGATTATCTCCAAAACTTGG - Intronic
1094596668 12:31872448-31872470 CTTTGAATATCAGAAAAACCAGG + Intergenic
1099005649 12:77232208-77232230 CTTGGATGATCCCCAACATCTGG - Intergenic
1100625758 12:96329896-96329918 TTTGGAATATCAGGAAAACCAGG + Intronic
1105301043 13:19134946-19134968 CTTGGATCATCAGCATAACCTGG + Intergenic
1107276885 13:38688253-38688275 CTCGGATCCTCACCAGAACCTGG - Exonic
1110480494 13:75968673-75968695 CTTGGATGTTCTCCAAAACATGG - Intergenic
1110629830 13:77696163-77696185 TTTTGGTTATTACCAAAACCTGG - Intergenic
1116334828 14:43644006-43644028 ATTAGCTTAACACCAAAACCAGG + Intergenic
1120931804 14:89856280-89856302 CCAGGATAATCACCCAAACCTGG - Intronic
1121213189 14:92224976-92224998 CTGGGATTATCTCCAAGAGCCGG - Intergenic
1125547257 15:40515140-40515162 TATGTACTATCACCAAAACCAGG + Intergenic
1126466714 15:48967283-48967305 ATTGGATTATCTTCAAAACTGGG - Intergenic
1131805952 15:96122891-96122913 CTCAGATTCTCACCAAAACGTGG + Intergenic
1131931812 15:97450740-97450762 ATTGAGTTATCACCCAAACCAGG + Intergenic
1133298956 16:4770177-4770199 CTTGGATGAACACCAAATTCAGG + Intergenic
1141014356 16:80434568-80434590 CATGCATAATCACCAAAAACTGG + Intergenic
1144010158 17:11140130-11140152 CTTGGATTACTACCAAAATTAGG - Intergenic
1146426666 17:32746441-32746463 CTGGGTTTATCACACAAACCTGG + Intronic
1149438422 17:56653951-56653973 CTTGGATTTCCACCAAAGGCAGG - Intergenic
1156171538 18:34492967-34492989 CTTGGGTTCTGACCAAAATCTGG + Intergenic
1159479186 18:68965893-68965915 TTTGGACTTTTACCAAAACCTGG - Intronic
1159480492 18:68984965-68984987 CTGAGATTATCTCCAAAACATGG - Intronic
1160080267 18:75719958-75719980 TTTGGATCATGACCAAATCCTGG + Intergenic
1163069618 19:14828177-14828199 CTGGGATTTTCACAAGAACCTGG - Exonic
1165126652 19:33602761-33602783 CATGAATTATCACCTCAACCTGG + Intergenic
1166976250 19:46606810-46606832 CTTGGTTTATCTCCATAGCCAGG + Intronic
1167130748 19:47583955-47583977 CTGGGAGAATCACCAGAACCTGG - Intergenic
1168379192 19:55905925-55905947 CTTTGATTCTCCCCAAATCCAGG - Intronic
1202697666 1_KI270712v1_random:136762-136784 CTAAGATTGTCACCAACACCAGG - Intergenic
925373940 2:3368299-3368321 TTCGGTTTACCACCAAAACCAGG - Intronic
925692704 2:6541357-6541379 CATCCATTATCTCCAAAACCTGG + Intergenic
929036376 2:37696138-37696160 CTTGATTTATAAGCAAAACCTGG - Intronic
930019815 2:46994693-46994715 ATAGGATTATCTCCACAACCTGG - Intronic
933319812 2:80759112-80759134 CTGGGATTTTCACCATTACCAGG - Intergenic
934278839 2:91593758-91593780 CTAAGATTGTCACCAACACCAGG - Intergenic
935168369 2:100589719-100589741 CTTGCTTTATCACCCAACCCTGG + Intergenic
935398720 2:102638024-102638046 CTTGGAAAATCAGCAAAACTGGG - Intronic
936672519 2:114674182-114674204 CATGTATTATAACAAAAACCTGG - Intronic
938993776 2:136656266-136656288 CTTTAATTCTCACCAAAACTGGG - Intergenic
941268514 2:163394966-163394988 TCTGGATTCTCACCACAACCAGG + Intergenic
942037443 2:172024311-172024333 CTTGGATTAATACCAAAAAGGGG + Intronic
1172700502 20:36850783-36850805 CTCCAATGATCACCAAAACCTGG + Intronic
1172943614 20:38671568-38671590 CTTGGATTATCACCCTCACTTGG - Intergenic
1173245814 20:41336689-41336711 ATTGGATTTTCACAAAACCCAGG - Intergenic
1175196075 20:57244219-57244241 CCTGCATTATCACCATCACCTGG - Intronic
1175674524 20:60935324-60935346 CTTGGATAATTACCCAAACGTGG - Intergenic
1178047144 21:28708450-28708472 CTGGGATTATAACCATACCCTGG - Intergenic
1183236787 22:36624669-36624691 CTTGAATTATCCCCAACCCCAGG + Intronic
957865355 3:86015885-86015907 CTTGATTTATAAGCAAAACCTGG + Intronic
957999141 3:87729707-87729729 CTTGGATCTTGGCCAAAACCAGG + Intergenic
960507365 3:118510132-118510154 TTTTAATTATAACCAAAACCAGG + Intergenic
961795444 3:129405585-129405607 CAAGTATTATCGCCAAAACCAGG + Intronic
962963778 3:140335181-140335203 CTTGGATTTTCATCAAGACCAGG - Intronic
963535382 3:146522136-146522158 CTTGGGGTATCATCAAAAACTGG - Intronic
964950233 3:162282448-162282470 TGTGGTATATCACCAAAACCTGG - Intergenic
967255470 3:187587560-187587582 ATTGGTATATCCCCAAAACCTGG + Intergenic
968867115 4:3220191-3220213 CTTGGATGGTCACCCAAACCGGG + Exonic
969918911 4:10518569-10518591 TTTGGAATATAACCAAAACTGGG + Intronic
972986702 4:44773937-44773959 CTTGGATTATTCCCAAAAACTGG + Intergenic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
977252098 4:94700786-94700808 CCTGGAGCATCACCAAAACAAGG - Intergenic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987782344 5:22455395-22455417 CTTGGATCATCAGCATTACCCGG + Intronic
995185609 5:109267516-109267538 TTTGGACTACCACCAGAACCAGG + Intergenic
997534737 5:134610471-134610493 CTTGGAGAATCACCTGAACCCGG + Intronic
1003583257 6:7361877-7361899 CTAGGATCATCACTAAAACTTGG - Intronic
1004337825 6:14780716-14780738 CTTTGATTATGAGCAAAACCAGG - Intergenic
1004504467 6:16237150-16237172 CTTTAATTCTCACAAAAACCAGG + Intergenic
1005976172 6:30801522-30801544 CATGGGTTATCAACAAAAACTGG - Intergenic
1009275045 6:61665393-61665415 CTTGCATTCTCAGAAAAACCAGG + Intergenic
1012761745 6:103310691-103310713 CTTGGGGTATCCCCTAAACCAGG + Intergenic
1013879746 6:114882484-114882506 CTTTGATTTTCCCCAAATCCTGG - Intergenic
1018085336 6:160296747-160296769 CTTGTGTTATCACCAAAAAAAGG - Intergenic
1022578581 7:31524113-31524135 CTTGGATACTCACCAATATCAGG - Intronic
1023552571 7:41385947-41385969 CTTGAATAATCACAACAACCTGG + Intergenic
1026142075 7:67714784-67714806 ATTGGATTCTCACAGAAACCTGG - Intergenic
1026143934 7:67729357-67729379 CTTTGATTATTATCAGAACCTGG + Intergenic
1027409474 7:77899746-77899768 CTTGGATTAGGACCAAAGACAGG + Intronic
1033627814 7:143128104-143128126 CTTGGAGCATGGCCAAAACCAGG - Intergenic
1035183776 7:157110213-157110235 CTTGTAGTCTCACCAAAAGCAGG - Intergenic
1037026346 8:14042991-14043013 CTAGGACTATCACCACAAACTGG - Intergenic
1037590457 8:20307728-20307750 GTTGGATAATCTCCAAAAGCCGG + Intergenic
1040789949 8:51216463-51216485 CTTGGCTTAAAACCAAAACATGG - Intergenic
1043303082 8:78759359-78759381 CTTGATTTATAAGCAAAACCTGG - Intronic
1044461872 8:92454985-92455007 CTTGGGTCATCAGCAAAGCCTGG - Intergenic
1051818063 9:21132980-21133002 CTTGGAATATGTCCAAAAGCAGG - Intergenic
1052532461 9:29705407-29705429 CTTGGGCTACCACAAAAACCAGG - Intergenic
1052602403 9:30651880-30651902 ATTGGATTATCACCTAAATGGGG + Intergenic
1053507646 9:38657337-38657359 CTAGGATTCTCAGCAACACCAGG - Intergenic
1053869833 9:42479349-42479371 CTTGATTTACCACCATAACCTGG - Intergenic
1054824665 9:69561111-69561133 CAAGGATTTTCACCAAACCCTGG - Intronic
1056767315 9:89452835-89452857 CATGGCTTATCTCCAAAGCCAGG + Intronic
1057029243 9:91761291-91761313 CTTGAATTATCCCCAAACCAAGG - Intronic
1057188919 9:93075457-93075479 CTTTGATTATGACCTAAACACGG - Intronic
1057678078 9:97151778-97151800 CTTGTACTACCACCAATACCTGG + Intergenic
1059306536 9:113357840-113357862 CTTGGATTACCAGCATGACCCGG + Intronic
1059528299 9:115013523-115013545 CAGGGATCATCACCTAAACCAGG + Intergenic
1186093724 X:6077785-6077807 TTTGGCTTATGACCAAAACCAGG + Intronic
1186578904 X:10795884-10795906 CTTGGATTATAACCAAGGCAAGG - Intronic
1188597696 X:31921706-31921728 ATTGAATTTTCACCACAACCTGG + Intronic
1192792450 X:74396089-74396111 CTTGATTTATAAACAAAACCTGG - Intergenic
1198318819 X:135498132-135498154 CTTGGATTATCACTACAGTCCGG - Intergenic
1201514552 Y:14804998-14805020 CTTGTATTACCACCAAAGCCTGG - Intronic