ID: 905493384

View in Genome Browser
Species Human (GRCh38)
Location 1:38362885-38362907
Sequence GTGTCATGAGAGGGACCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9808
Summary {0: 38, 1: 405, 2: 1223, 3: 3076, 4: 5066}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905493384_905493393 20 Left 905493384 1:38362885-38362907 CCACTGGGTCCCTCTCATGACAC 0: 38
1: 405
2: 1223
3: 3076
4: 5066
Right 905493393 1:38362928-38362950 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
905493384_905493394 21 Left 905493384 1:38362885-38362907 CCACTGGGTCCCTCTCATGACAC 0: 38
1: 405
2: 1223
3: 3076
4: 5066
Right 905493394 1:38362929-38362951 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
905493384_905493392 17 Left 905493384 1:38362885-38362907 CCACTGGGTCCCTCTCATGACAC 0: 38
1: 405
2: 1223
3: 3076
4: 5066
Right 905493392 1:38362925-38362947 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
905493384_905493390 -10 Left 905493384 1:38362885-38362907 CCACTGGGTCCCTCTCATGACAC 0: 38
1: 405
2: 1223
3: 3076
4: 5066
Right 905493390 1:38362898-38362920 CTCATGACACATGGGGATTATGG 0: 38
1: 520
2: 1401
3: 2689
4: 4142
905493384_905493391 16 Left 905493384 1:38362885-38362907 CCACTGGGTCCCTCTCATGACAC 0: 38
1: 405
2: 1223
3: 3076
4: 5066
Right 905493391 1:38362924-38362946 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
905493384_905493395 22 Left 905493384 1:38362885-38362907 CCACTGGGTCCCTCTCATGACAC 0: 38
1: 405
2: 1223
3: 3076
4: 5066
Right 905493395 1:38362930-38362952 TTCAAGATGAGATTTGGGTGGGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905493384 Original CRISPR GTGTCATGAGAGGGACCCAG TGG (reversed) Intergenic
Too many off-targets to display for this crispr