ID: 905493388

View in Genome Browser
Species Human (GRCh38)
Location 1:38362894-38362916
Sequence AATCCCCATGTGTCATGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11292
Summary {0: 42, 1: 588, 2: 1500, 3: 3288, 4: 5874}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905493388_905493393 11 Left 905493388 1:38362894-38362916 CCCTCTCATGACACATGGGGATT 0: 42
1: 588
2: 1500
3: 3288
4: 5874
Right 905493393 1:38362928-38362950 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
905493388_905493394 12 Left 905493388 1:38362894-38362916 CCCTCTCATGACACATGGGGATT 0: 42
1: 588
2: 1500
3: 3288
4: 5874
Right 905493394 1:38362929-38362951 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
905493388_905493391 7 Left 905493388 1:38362894-38362916 CCCTCTCATGACACATGGGGATT 0: 42
1: 588
2: 1500
3: 3288
4: 5874
Right 905493391 1:38362924-38362946 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
905493388_905493392 8 Left 905493388 1:38362894-38362916 CCCTCTCATGACACATGGGGATT 0: 42
1: 588
2: 1500
3: 3288
4: 5874
Right 905493392 1:38362925-38362947 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
905493388_905493395 13 Left 905493388 1:38362894-38362916 CCCTCTCATGACACATGGGGATT 0: 42
1: 588
2: 1500
3: 3288
4: 5874
Right 905493395 1:38362930-38362952 TTCAAGATGAGATTTGGGTGGGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905493388 Original CRISPR AATCCCCATGTGTCATGAGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr