ID: 905493390

View in Genome Browser
Species Human (GRCh38)
Location 1:38362898-38362920
Sequence CTCATGACACATGGGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8790
Summary {0: 38, 1: 520, 2: 1401, 3: 2689, 4: 4142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905493383_905493390 -6 Left 905493383 1:38362881-38362903 CCTTCCACTGGGTCCCTCTCATG No data
Right 905493390 1:38362898-38362920 CTCATGACACATGGGGATTATGG 0: 38
1: 520
2: 1401
3: 2689
4: 4142
905493379_905493390 9 Left 905493379 1:38362866-38362888 CCCATGATTTAATTACCTTCCAC No data
Right 905493390 1:38362898-38362920 CTCATGACACATGGGGATTATGG 0: 38
1: 520
2: 1401
3: 2689
4: 4142
905493384_905493390 -10 Left 905493384 1:38362885-38362907 CCACTGGGTCCCTCTCATGACAC 0: 38
1: 405
2: 1223
3: 3076
4: 5066
Right 905493390 1:38362898-38362920 CTCATGACACATGGGGATTATGG 0: 38
1: 520
2: 1401
3: 2689
4: 4142
905493380_905493390 8 Left 905493380 1:38362867-38362889 CCATGATTTAATTACCTTCCACT No data
Right 905493390 1:38362898-38362920 CTCATGACACATGGGGATTATGG 0: 38
1: 520
2: 1401
3: 2689
4: 4142
905493378_905493390 15 Left 905493378 1:38362860-38362882 CCTGCTCCCATGATTTAATTACC No data
Right 905493390 1:38362898-38362920 CTCATGACACATGGGGATTATGG 0: 38
1: 520
2: 1401
3: 2689
4: 4142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905493390 Original CRISPR CTCATGACACATGGGGATTA TGG Intergenic
Too many off-targets to display for this crispr