ID: 905493391

View in Genome Browser
Species Human (GRCh38)
Location 1:38362924-38362946
Sequence CTACAATTCAAGATGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38431
Summary {0: 4048, 1: 7216, 2: 8939, 3: 8984, 4: 9244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905493384_905493391 16 Left 905493384 1:38362885-38362907 CCACTGGGTCCCTCTCATGACAC 0: 38
1: 405
2: 1223
3: 3076
4: 5066
Right 905493391 1:38362924-38362946 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
905493383_905493391 20 Left 905493383 1:38362881-38362903 CCTTCCACTGGGTCCCTCTCATG No data
Right 905493391 1:38362924-38362946 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
905493389_905493391 6 Left 905493389 1:38362895-38362917 CCTCTCATGACACATGGGGATTA 0: 44
1: 582
2: 1729
3: 3340
4: 5391
Right 905493391 1:38362924-38362946 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
905493388_905493391 7 Left 905493388 1:38362894-38362916 CCCTCTCATGACACATGGGGATT 0: 42
1: 588
2: 1500
3: 3288
4: 5874
Right 905493391 1:38362924-38362946 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905493391 Original CRISPR CTACAATTCAAGATGAGATT TGG Intergenic
Too many off-targets to display for this crispr