ID: 905493392

View in Genome Browser
Species Human (GRCh38)
Location 1:38362925-38362947
Sequence TACAATTCAAGATGAGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39211
Summary {0: 6802, 1: 10434, 2: 9513, 3: 7783, 4: 4679}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905493384_905493392 17 Left 905493384 1:38362885-38362907 CCACTGGGTCCCTCTCATGACAC 0: 38
1: 405
2: 1223
3: 3076
4: 5066
Right 905493392 1:38362925-38362947 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
905493389_905493392 7 Left 905493389 1:38362895-38362917 CCTCTCATGACACATGGGGATTA 0: 44
1: 582
2: 1729
3: 3340
4: 5391
Right 905493392 1:38362925-38362947 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
905493383_905493392 21 Left 905493383 1:38362881-38362903 CCTTCCACTGGGTCCCTCTCATG No data
Right 905493392 1:38362925-38362947 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
905493388_905493392 8 Left 905493388 1:38362894-38362916 CCCTCTCATGACACATGGGGATT 0: 42
1: 588
2: 1500
3: 3288
4: 5874
Right 905493392 1:38362925-38362947 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905493392 Original CRISPR TACAATTCAAGATGAGATTT GGG Intergenic
Too many off-targets to display for this crispr