ID: 905493937

View in Genome Browser
Species Human (GRCh38)
Location 1:38369813-38369835
Sequence TGTACTGTACCTACTACAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905493934_905493937 25 Left 905493934 1:38369765-38369787 CCCAAGGTAGTTATTGCTACGTG No data
Right 905493937 1:38369813-38369835 TGTACTGTACCTACTACAGCGGG No data
905493935_905493937 24 Left 905493935 1:38369766-38369788 CCAAGGTAGTTATTGCTACGTGT No data
Right 905493937 1:38369813-38369835 TGTACTGTACCTACTACAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905493937 Original CRISPR TGTACTGTACCTACTACAGC GGG Intergenic
No off target data available for this crispr