ID: 905494303

View in Genome Browser
Species Human (GRCh38)
Location 1:38372425-38372447
Sequence ACCTGGCTATAGTGGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905494303_905494310 2 Left 905494303 1:38372425-38372447 CCAGCTACCCACTATAGCCAGGT No data
Right 905494310 1:38372450-38372472 GCTTCTGGGCAGGTTCACTGTGG No data
905494303_905494308 -8 Left 905494303 1:38372425-38372447 CCAGCTACCCACTATAGCCAGGT No data
Right 905494308 1:38372440-38372462 AGCCAGGTCAGCTTCTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905494303 Original CRISPR ACCTGGCTATAGTGGGTAGC TGG (reversed) Intergenic
No off target data available for this crispr