ID: 905499174

View in Genome Browser
Species Human (GRCh38)
Location 1:38422549-38422571
Sequence AGGAATATACAAATGAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905499174_905499176 -3 Left 905499174 1:38422549-38422571 CCATTGTTCATTTGTATATTCCT No data
Right 905499176 1:38422569-38422591 CCTCATCTCAGTACATCAAAAGG No data
905499174_905499177 4 Left 905499174 1:38422549-38422571 CCATTGTTCATTTGTATATTCCT No data
Right 905499177 1:38422576-38422598 TCAGTACATCAAAAGGAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905499174 Original CRISPR AGGAATATACAAATGAACAA TGG (reversed) Intergenic
No off target data available for this crispr