ID: 905499802

View in Genome Browser
Species Human (GRCh38)
Location 1:38427416-38427438
Sequence GGTCCCACACAGATGGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905499802_905499805 -9 Left 905499802 1:38427416-38427438 CCGTGTTCCATCTGTGTGGGACC No data
Right 905499805 1:38427430-38427452 TGTGGGACCCCACTGGAAATCGG No data
905499802_905499809 9 Left 905499802 1:38427416-38427438 CCGTGTTCCATCTGTGTGGGACC No data
Right 905499809 1:38427448-38427470 ATCGGACTGTGTAACTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905499802 Original CRISPR GGTCCCACACAGATGGAACA CGG (reversed) Intergenic
No off target data available for this crispr