ID: 905502887

View in Genome Browser
Species Human (GRCh38)
Location 1:38453478-38453500
Sequence AACCCCATGCTGTTAGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905502884_905502887 -1 Left 905502884 1:38453456-38453478 CCCAGGGTGGGAATGACCAGAGA No data
Right 905502887 1:38453478-38453500 AACCCCATGCTGTTAGTCCAAGG No data
905502885_905502887 -2 Left 905502885 1:38453457-38453479 CCAGGGTGGGAATGACCAGAGAA No data
Right 905502887 1:38453478-38453500 AACCCCATGCTGTTAGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905502887 Original CRISPR AACCCCATGCTGTTAGTCCA AGG Intergenic
No off target data available for this crispr