ID: 905503832

View in Genome Browser
Species Human (GRCh38)
Location 1:38460609-38460631
Sequence GAGGAGAGACATACTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905503832_905503836 4 Left 905503832 1:38460609-38460631 CCAACCTCAGTATGTCTCTCCTC No data
Right 905503836 1:38460636-38460658 CCTGAAATGCCCATCGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905503832 Original CRISPR GAGGAGAGACATACTGAGGT TGG (reversed) Intergenic
No off target data available for this crispr