ID: 905508219

View in Genome Browser
Species Human (GRCh38)
Location 1:38497440-38497462
Sequence GTCTCGGGTAACACGGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905508215_905508219 26 Left 905508215 1:38497391-38497413 CCTACTTTTAATGAATGACTAGA No data
Right 905508219 1:38497440-38497462 GTCTCGGGTAACACGGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905508219 Original CRISPR GTCTCGGGTAACACGGTCTT TGG Intergenic
No off target data available for this crispr