ID: 905514578

View in Genome Browser
Species Human (GRCh38)
Location 1:38552848-38552870
Sequence CAGCTCAGGCTGCCATAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905514576_905514578 -8 Left 905514576 1:38552833-38552855 CCTAGGTGTGTTCGTCAGCTCAG No data
Right 905514578 1:38552848-38552870 CAGCTCAGGCTGCCATAAACTGG No data
905514575_905514578 -1 Left 905514575 1:38552826-38552848 CCTAGCTCCTAGGTGTGTTCGTC No data
Right 905514578 1:38552848-38552870 CAGCTCAGGCTGCCATAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905514578 Original CRISPR CAGCTCAGGCTGCCATAAAC TGG Intergenic
No off target data available for this crispr