ID: 905514956 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:38555839-38555861 |
Sequence | CAGGGTTACTGGAGGGAAAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
905514945_905514956 | 8 | Left | 905514945 | 1:38555808-38555830 | CCAATACTCTTATAGCCGCAGCC | No data | ||
Right | 905514956 | 1:38555839-38555861 | CAGGGTTACTGGAGGGAAAGGGG | No data | ||||
905514948_905514956 | -7 | Left | 905514948 | 1:38555823-38555845 | CCGCAGCCACAACCAGCAGGGTT | No data | ||
Right | 905514956 | 1:38555839-38555861 | CAGGGTTACTGGAGGGAAAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
905514956 | Original CRISPR | CAGGGTTACTGGAGGGAAAG GGG | Intergenic | ||
No off target data available for this crispr |