ID: 905514956

View in Genome Browser
Species Human (GRCh38)
Location 1:38555839-38555861
Sequence CAGGGTTACTGGAGGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905514945_905514956 8 Left 905514945 1:38555808-38555830 CCAATACTCTTATAGCCGCAGCC No data
Right 905514956 1:38555839-38555861 CAGGGTTACTGGAGGGAAAGGGG No data
905514948_905514956 -7 Left 905514948 1:38555823-38555845 CCGCAGCCACAACCAGCAGGGTT No data
Right 905514956 1:38555839-38555861 CAGGGTTACTGGAGGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905514956 Original CRISPR CAGGGTTACTGGAGGGAAAG GGG Intergenic
No off target data available for this crispr