ID: 905514999

View in Genome Browser
Species Human (GRCh38)
Location 1:38556146-38556168
Sequence CAGATTCCTCAGAGGGAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905514994_905514999 -8 Left 905514994 1:38556131-38556153 CCACTGAGGGACGCCCAGATTCC No data
Right 905514999 1:38556146-38556168 CAGATTCCTCAGAGGGAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905514999 Original CRISPR CAGATTCCTCAGAGGGAAGT CGG Intergenic
No off target data available for this crispr