ID: 905515683

View in Genome Browser
Species Human (GRCh38)
Location 1:38560206-38560228
Sequence GCCCCCAGCACAAAAAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905515683_905515688 1 Left 905515683 1:38560206-38560228 CCTTAGCTTTTTGTGCTGGGGGC No data
Right 905515688 1:38560230-38560252 TAGCCCCAGGGTTAGGATTAGGG No data
905515683_905515695 13 Left 905515683 1:38560206-38560228 CCTTAGCTTTTTGTGCTGGGGGC No data
Right 905515695 1:38560242-38560264 TAGGATTAGGGTTAAGGGGATGG No data
905515683_905515694 9 Left 905515683 1:38560206-38560228 CCTTAGCTTTTTGTGCTGGGGGC No data
Right 905515694 1:38560238-38560260 GGGTTAGGATTAGGGTTAAGGGG No data
905515683_905515687 0 Left 905515683 1:38560206-38560228 CCTTAGCTTTTTGTGCTGGGGGC No data
Right 905515687 1:38560229-38560251 TTAGCCCCAGGGTTAGGATTAGG No data
905515683_905515692 7 Left 905515683 1:38560206-38560228 CCTTAGCTTTTTGTGCTGGGGGC No data
Right 905515692 1:38560236-38560258 CAGGGTTAGGATTAGGGTTAAGG No data
905515683_905515693 8 Left 905515683 1:38560206-38560228 CCTTAGCTTTTTGTGCTGGGGGC No data
Right 905515693 1:38560237-38560259 AGGGTTAGGATTAGGGTTAAGGG No data
905515683_905515686 -6 Left 905515683 1:38560206-38560228 CCTTAGCTTTTTGTGCTGGGGGC No data
Right 905515686 1:38560223-38560245 GGGGGCTTAGCCCCAGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905515683 Original CRISPR GCCCCCAGCACAAAAAGCTA AGG (reversed) Intergenic
No off target data available for this crispr