ID: 905516174

View in Genome Browser
Species Human (GRCh38)
Location 1:38563597-38563619
Sequence GCCATTAGTCCCCACCTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905516174_905516177 5 Left 905516174 1:38563597-38563619 CCAGATAGGTGGGGACTAATGGC No data
Right 905516177 1:38563625-38563647 CCAACCAAGATGAAAGTGCATGG No data
905516174_905516179 20 Left 905516174 1:38563597-38563619 CCAGATAGGTGGGGACTAATGGC No data
Right 905516179 1:38563640-38563662 GTGCATGGCCCACTCTTTTTTGG No data
905516174_905516181 25 Left 905516174 1:38563597-38563619 CCAGATAGGTGGGGACTAATGGC No data
Right 905516181 1:38563645-38563667 TGGCCCACTCTTTTTTGGATGGG No data
905516174_905516180 24 Left 905516174 1:38563597-38563619 CCAGATAGGTGGGGACTAATGGC No data
Right 905516180 1:38563644-38563666 ATGGCCCACTCTTTTTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905516174 Original CRISPR GCCATTAGTCCCCACCTATC TGG (reversed) Intergenic