ID: 905516177

View in Genome Browser
Species Human (GRCh38)
Location 1:38563625-38563647
Sequence CCAACCAAGATGAAAGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905516171_905516177 7 Left 905516171 1:38563595-38563617 CCCCAGATAGGTGGGGACTAATG No data
Right 905516177 1:38563625-38563647 CCAACCAAGATGAAAGTGCATGG No data
905516172_905516177 6 Left 905516172 1:38563596-38563618 CCCAGATAGGTGGGGACTAATGG No data
Right 905516177 1:38563625-38563647 CCAACCAAGATGAAAGTGCATGG No data
905516174_905516177 5 Left 905516174 1:38563597-38563619 CCAGATAGGTGGGGACTAATGGC No data
Right 905516177 1:38563625-38563647 CCAACCAAGATGAAAGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905516177 Original CRISPR CCAACCAAGATGAAAGTGCA TGG Intergenic
No off target data available for this crispr