ID: 905516181

View in Genome Browser
Species Human (GRCh38)
Location 1:38563645-38563667
Sequence TGGCCCACTCTTTTTTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905516175_905516181 -2 Left 905516175 1:38563624-38563646 CCCAACCAAGATGAAAGTGCATG No data
Right 905516181 1:38563645-38563667 TGGCCCACTCTTTTTTGGATGGG No data
905516174_905516181 25 Left 905516174 1:38563597-38563619 CCAGATAGGTGGGGACTAATGGC No data
Right 905516181 1:38563645-38563667 TGGCCCACTCTTTTTTGGATGGG No data
905516172_905516181 26 Left 905516172 1:38563596-38563618 CCCAGATAGGTGGGGACTAATGG No data
Right 905516181 1:38563645-38563667 TGGCCCACTCTTTTTTGGATGGG No data
905516171_905516181 27 Left 905516171 1:38563595-38563617 CCCCAGATAGGTGGGGACTAATG No data
Right 905516181 1:38563645-38563667 TGGCCCACTCTTTTTTGGATGGG No data
905516176_905516181 -3 Left 905516176 1:38563625-38563647 CCAACCAAGATGAAAGTGCATGG No data
Right 905516181 1:38563645-38563667 TGGCCCACTCTTTTTTGGATGGG No data
905516178_905516181 -7 Left 905516178 1:38563629-38563651 CCAAGATGAAAGTGCATGGCCCA No data
Right 905516181 1:38563645-38563667 TGGCCCACTCTTTTTTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905516181 Original CRISPR TGGCCCACTCTTTTTTGGAT GGG Intergenic
No off target data available for this crispr