ID: 905517654

View in Genome Browser
Species Human (GRCh38)
Location 1:38573774-38573796
Sequence CTTAAATCTTTTATGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905517651_905517654 7 Left 905517651 1:38573744-38573766 CCCAGAGTCTTAATCTATATATC No data
Right 905517654 1:38573774-38573796 CTTAAATCTTTTATGGAACAAGG No data
905517650_905517654 23 Left 905517650 1:38573728-38573750 CCACATTGATAACTGTCCCAGAG No data
Right 905517654 1:38573774-38573796 CTTAAATCTTTTATGGAACAAGG No data
905517652_905517654 6 Left 905517652 1:38573745-38573767 CCAGAGTCTTAATCTATATATCT No data
Right 905517654 1:38573774-38573796 CTTAAATCTTTTATGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905517654 Original CRISPR CTTAAATCTTTTATGGAACA AGG Intergenic
No off target data available for this crispr