ID: 905519425

View in Genome Browser
Species Human (GRCh38)
Location 1:38586754-38586776
Sequence GGGCACAGTGGAGCACGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905519416_905519425 -3 Left 905519416 1:38586734-38586756 CCAAACATCCCCTGGGGATGGGG No data
Right 905519425 1:38586754-38586776 GGGCACAGTGGAGCACGGGGTGG No data
905519409_905519425 7 Left 905519409 1:38586724-38586746 CCCGGCAATGCCAAACATCCCCT No data
Right 905519425 1:38586754-38586776 GGGCACAGTGGAGCACGGGGTGG No data
905519408_905519425 17 Left 905519408 1:38586714-38586736 CCAAAAATCTCCCGGCAATGCCA No data
Right 905519425 1:38586754-38586776 GGGCACAGTGGAGCACGGGGTGG No data
905519410_905519425 6 Left 905519410 1:38586725-38586747 CCGGCAATGCCAAACATCCCCTG No data
Right 905519425 1:38586754-38586776 GGGCACAGTGGAGCACGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905519425 Original CRISPR GGGCACAGTGGAGCACGGGG TGG Intergenic
No off target data available for this crispr