ID: 905520189

View in Genome Browser
Species Human (GRCh38)
Location 1:38592680-38592702
Sequence GGGTATCACGGAGAAGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905520189_905520193 -10 Left 905520189 1:38592680-38592702 CCCACTACTTCTCCGTGATACCC No data
Right 905520193 1:38592693-38592715 CGTGATACCCCCATGCAGCAGGG No data
905520189_905520194 -9 Left 905520189 1:38592680-38592702 CCCACTACTTCTCCGTGATACCC No data
Right 905520194 1:38592694-38592716 GTGATACCCCCATGCAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905520189 Original CRISPR GGGTATCACGGAGAAGTAGT GGG (reversed) Intergenic