ID: 905520193

View in Genome Browser
Species Human (GRCh38)
Location 1:38592693-38592715
Sequence CGTGATACCCCCATGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905520189_905520193 -10 Left 905520189 1:38592680-38592702 CCCACTACTTCTCCGTGATACCC No data
Right 905520193 1:38592693-38592715 CGTGATACCCCCATGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905520193 Original CRISPR CGTGATACCCCCATGCAGCA GGG Intergenic
No off target data available for this crispr