ID: 905521380

View in Genome Browser
Species Human (GRCh38)
Location 1:38603150-38603172
Sequence CTGCACTTCTGGAGAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905521373_905521380 -4 Left 905521373 1:38603131-38603153 CCATGGCCCTTCCCCTGAACTGC No data
Right 905521380 1:38603150-38603172 CTGCACTTCTGGAGAAAAAAAGG No data
905521374_905521380 -10 Left 905521374 1:38603137-38603159 CCCTTCCCCTGAACTGCACTTCT No data
Right 905521380 1:38603150-38603172 CTGCACTTCTGGAGAAAAAAAGG No data
905521372_905521380 5 Left 905521372 1:38603122-38603144 CCTCATTTTCCATGGCCCTTCCC No data
Right 905521380 1:38603150-38603172 CTGCACTTCTGGAGAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905521380 Original CRISPR CTGCACTTCTGGAGAAAAAA AGG Intergenic
No off target data available for this crispr