ID: 905528604

View in Genome Browser
Species Human (GRCh38)
Location 1:38658687-38658709
Sequence TACAAAACCCACTTCAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905528604_905528607 -3 Left 905528604 1:38658687-38658709 CCCCATCTGAAGTGGGTTTTGTA No data
Right 905528607 1:38658707-38658729 GTAGAATATTCCCTTCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905528604 Original CRISPR TACAAAACCCACTTCAGATG GGG (reversed) Intergenic
No off target data available for this crispr