ID: 905533198

View in Genome Browser
Species Human (GRCh38)
Location 1:38698557-38698579
Sequence GTTGCACAAGAGTCTCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905533188_905533198 7 Left 905533188 1:38698527-38698549 CCATGCCCCAGCTCAGAGCTTCC No data
Right 905533198 1:38698557-38698579 GTTGCACAAGAGTCTCTGGTGGG No data
905533186_905533198 24 Left 905533186 1:38698510-38698532 CCTCTTCTTCACACGTCCCATGC No data
Right 905533198 1:38698557-38698579 GTTGCACAAGAGTCTCTGGTGGG No data
905533185_905533198 28 Left 905533185 1:38698506-38698528 CCTTCCTCTTCTTCACACGTCCC No data
Right 905533198 1:38698557-38698579 GTTGCACAAGAGTCTCTGGTGGG No data
905533190_905533198 1 Left 905533190 1:38698533-38698555 CCCAGCTCAGAGCTTCCCACCCT No data
Right 905533198 1:38698557-38698579 GTTGCACAAGAGTCTCTGGTGGG No data
905533191_905533198 0 Left 905533191 1:38698534-38698556 CCAGCTCAGAGCTTCCCACCCTA No data
Right 905533198 1:38698557-38698579 GTTGCACAAGAGTCTCTGGTGGG No data
905533187_905533198 8 Left 905533187 1:38698526-38698548 CCCATGCCCCAGCTCAGAGCTTC No data
Right 905533198 1:38698557-38698579 GTTGCACAAGAGTCTCTGGTGGG No data
905533189_905533198 2 Left 905533189 1:38698532-38698554 CCCCAGCTCAGAGCTTCCCACCC No data
Right 905533198 1:38698557-38698579 GTTGCACAAGAGTCTCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905533198 Original CRISPR GTTGCACAAGAGTCTCTGGT GGG Intergenic