ID: 905537133

View in Genome Browser
Species Human (GRCh38)
Location 1:38731036-38731058
Sequence CTAATCTGTTAGTAGAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905537133_905537135 23 Left 905537133 1:38731036-38731058 CCTGTGTTCTACTAACAGATTAG No data
Right 905537135 1:38731082-38731104 AGTGTGATTCCCAGACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905537133 Original CRISPR CTAATCTGTTAGTAGAACAC AGG (reversed) Intergenic
No off target data available for this crispr