ID: 905540006

View in Genome Browser
Species Human (GRCh38)
Location 1:38753007-38753029
Sequence GCCATCAATTCCTACTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905540006_905540008 -2 Left 905540006 1:38753007-38753029 CCTGTAAAGTAGGAATTGATGGC No data
Right 905540008 1:38753028-38753050 GCATTACCTACCTCACAGGCTGG No data
905540006_905540007 -6 Left 905540006 1:38753007-38753029 CCTGTAAAGTAGGAATTGATGGC No data
Right 905540007 1:38753024-38753046 GATGGCATTACCTACCTCACAGG No data
905540006_905540011 22 Left 905540006 1:38753007-38753029 CCTGTAAAGTAGGAATTGATGGC No data
Right 905540011 1:38753052-38753074 TGTGAGAATTAAACAAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905540006 Original CRISPR GCCATCAATTCCTACTTTAC AGG (reversed) Intergenic
No off target data available for this crispr