ID: 905541268

View in Genome Browser
Species Human (GRCh38)
Location 1:38762326-38762348
Sequence GTTAGAACACAGACATCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905541257_905541268 28 Left 905541257 1:38762275-38762297 CCCGTAAAGTCCCTATTGCCTTC No data
Right 905541268 1:38762326-38762348 GTTAGAACACAGACATCTTTGGG No data
905541259_905541268 18 Left 905541259 1:38762285-38762307 CCCTATTGCCTTCTAAAGCAAAG No data
Right 905541268 1:38762326-38762348 GTTAGAACACAGACATCTTTGGG No data
905541260_905541268 17 Left 905541260 1:38762286-38762308 CCTATTGCCTTCTAAAGCAAAGT No data
Right 905541268 1:38762326-38762348 GTTAGAACACAGACATCTTTGGG No data
905541261_905541268 10 Left 905541261 1:38762293-38762315 CCTTCTAAAGCAAAGTAGTCACA No data
Right 905541268 1:38762326-38762348 GTTAGAACACAGACATCTTTGGG No data
905541258_905541268 27 Left 905541258 1:38762276-38762298 CCGTAAAGTCCCTATTGCCTTCT No data
Right 905541268 1:38762326-38762348 GTTAGAACACAGACATCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905541268 Original CRISPR GTTAGAACACAGACATCTTT GGG Intergenic
No off target data available for this crispr