ID: 905541859

View in Genome Browser
Species Human (GRCh38)
Location 1:38766266-38766288
Sequence CAGGCTCCTTGCCCCTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905541859_905541862 -6 Left 905541859 1:38766266-38766288 CCTTCACAGGGGCAAGGAGCCTG No data
Right 905541862 1:38766283-38766305 AGCCTGCTCAGGGTCTCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905541859 Original CRISPR CAGGCTCCTTGCCCCTGTGA AGG (reversed) Intergenic
No off target data available for this crispr