ID: 905541862 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:38766283-38766305 |
Sequence | AGCCTGCTCAGGGTCTCCCG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
905541859_905541862 | -6 | Left | 905541859 | 1:38766266-38766288 | CCTTCACAGGGGCAAGGAGCCTG | No data | ||
Right | 905541862 | 1:38766283-38766305 | AGCCTGCTCAGGGTCTCCCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
905541862 | Original CRISPR | AGCCTGCTCAGGGTCTCCCG TGG | Intergenic | ||