ID: 905543062

View in Genome Browser
Species Human (GRCh38)
Location 1:38775467-38775489
Sequence TAGGGTAAAGAAGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905543062_905543070 27 Left 905543062 1:38775467-38775489 CCTTCCTCCTCTTCTTTACCCTA No data
Right 905543070 1:38775517-38775539 GCTCAAAGTCATTGCTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905543062 Original CRISPR TAGGGTAAAGAAGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr